*Target (protein/gene name): Dihydrofolate Synthase *NCBI Gene # or RefSeq#: 5300149/WP_003229640.1. *Protein ID (NP or XP #) or Wolbachia#: YP_001295464.1 *Organism (including strain): Dihydrofolate/Polyglutamate SYNTHASE (Gamma-Glutamate Synthase), Mycobacterium leprae strain TN
*Etiologic Risk Group (see link below): https://www.ncbi.nlm.nih.gov/pubmed/15256520 https://www.ncbi.nlm.nih.gov/pubmed/16715690 *Disease Information: Leprosy is a chronic infectious disease that mainly affects the skin, the peripheral nerves, mucosal surfaces of the upper respiratory tract, and the eyes. Leprosy is known to occur at all ages ranging from early infancy to very old age. The mechanism of transmission of leprosy is not known. Leprosy can lead to numbness and the eventual loss of feeling in the extremities, if left untreated. As a result, a person becomes more vulnerable to infection from injuries as these injuries can go unnoticed and may result in the loss of fingers or toes. Leprosy is a disease in developing countries that experiences 250,000 new cases of Leprosy each year. The bacteria causing the disease can incubate in the body anywhere between three years and a decade. Leprosy causes nerve injury by binding to Schwann cells, inducing demyelination in peripheral nerves and loss of conductance within the axons of nerve cells. Leprosy has recently been treated with a multidrug therapy, lasting between six months and a year depending on the classification of the bacteria strain.
Essentiality of this protein: Gene/Ortholog: mtu2490 (OG4_10366); Phenotype: essential; Source study: nmpdr Gene/Ortholog: sce4868 (OG4_10366); Phenotype: inviable; Source study: yeastgenome Gene/Ortholog: eco2244 (OG4_10366); Phenotype: undefined; Source study: blattner Gene/Ortholog: eco2244 (OG4_10366); Phenotype: undefined; Source study: gerdes Gene/Ortholog: eco2244 (OG4_10366); Phenotype: essential; Source study: keio Gene/Ortholog: eco2244 (OG4_10366); Phenotype: non-essential; Source study: shigen Gene/Ortholog: Tb927.10.7520 (OG4_10366); Phenotype: no significant loss or gain of fitness in bloodstream forms (3 days); Source study: alsford Gene/Ortholog: Tb927.10.7520 (OG4_10366); Phenotype: no significant loss or gain of fitness in bloodstream forms (6 days); Source study: alsford Gene/Ortholog: Tb927.10.7520 (OG4_10366); Phenotype: no significant loss or gain of fitness in procyclic forms; Source study: alsford Gene/Ortholog: Tb927.10.7520 (OG4_10366); Phenotype: no significant loss or gain of fitness in differentiation of procyclic to bloodstream forms; Source study: alsford
Structure (PDB or Homology model) -- PDB # or closest PDB entry if using homology model: 3N2A
Current Inhibitors: Most inhibitors are sulfonamides. H2-folate, and antimetabolite dihydrohomopteroate. Expression Information (has it been expressed in bacterial cells): It has been expressed in E. coli plasmids. Purification Method: Purification methods include ammonium sulfate fractionation, isoelectric focusing, polyacrylamide gel electrophoresis, and column chromatography using various types of products.
Image of protein (PyMol with features delineated and shown separately):
*Amino Acid Sequence (paste as text only - not as screenshot or as 'code'):
Length of your protein in Amino Acids: 437 residues Molecular Weight of your protein in kiloDaltons using the Expasy ProtParam website: 47500.87 Molar Extinction coefficient of your protein at 280 nm wavelength: 52, 285 1/Mcm, assuming all pairs of Cys residues form cystines and 51,910 1/Mcm assuming all Cys residues are reduced. TMpred graph Image (http://www.ch.embnet.org/software/TMPRED_form.html). Input your amino acid sequence to it. *CDS Gene Sequence (paste as text only): GTGTCGAGGTCGCTGGCACAACGTTATAGGGCTGAGGCTTACAACGTCATCGCCACTGCG ACTTGCACACGGCCGACCGAGCTGGTTATCGATGGCATTGACGTGACTCAGGCGGAGTTC GAATATGCGGTGACCTATGAATGTGCATTGGATGTTGCCGACCACGCCAATGAGTTCGAC ACACGGGCCACAGCACCGCAGCGACCTGTGCGAGTCAGCATCGGACGGGGCATTGTTGGG GTGATTGAGGCCTTGGGTG *GC% Content for gene: 57.76 *CDS Gene Sequence (codon optimized) - copy from output of Primer Design Protocol (paste as text only): n/a *GC% Content for gene (codon optimized): n/a
Do Not Need this info for Spring Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers): (link to DNA Works output text file - that should be saved in your Google Docs folder after you did the primer design protocol) -- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to.
Primer design results for 'tail' primers (this is just 2 sequences): **
*NCBI Gene # or RefSeq#: 5300149/WP_003229640.1.
*Protein ID (NP or XP #) or Wolbachia#: YP_001295464.1
*Organism (including strain): Dihydrofolate/Polyglutamate SYNTHASE (Gamma-Glutamate Synthase), Mycobacterium leprae strain TN
*Etiologic Risk Group (see link below):
https://www.ncbi.nlm.nih.gov/pubmed/15256520
https://www.ncbi.nlm.nih.gov/pubmed/16715690
*Disease Information: Leprosy is a chronic infectious disease that mainly affects the skin, the peripheral nerves, mucosal surfaces of the upper respiratory tract, and the eyes. Leprosy is known to occur at all ages ranging from early infancy to very old age. The mechanism of transmission of leprosy is not known. Leprosy can lead to numbness and the eventual loss of feeling in the extremities, if left untreated. As a result, a person becomes more vulnerable to infection from injuries as these injuries can go unnoticed and may result in the loss of fingers or toes. Leprosy is a disease in developing countries that experiences 250,000 new cases of Leprosy each year. The bacteria causing the disease can incubate in the body anywhere between three years and a decade. Leprosy causes nerve injury by binding to Schwann cells, inducing demyelination in peripheral nerves and loss of conductance within the axons of nerve cells. Leprosy has recently been treated with a multidrug therapy, lasting between six months and a year depending on the classification of the bacteria strain.
Link to TDR Targets page (if present): http://tdrtargets.org/targets/view?gene_id=256099
Link to Gene Database page (NCBI, EuPath databases -e.g. TryTryp, PlasmoDB, etc - or PATRIC, etc.): https://www.ncbi.nlm.nih.gov/gene/5300149
Essentiality of this protein:
Gene/Ortholog: mtu2490 (OG4_10366); Phenotype: essential; Source study: nmpdr
Gene/Ortholog: sce4868 (OG4_10366); Phenotype: inviable; Source study: yeastgenome
Gene/Ortholog: eco2244 (OG4_10366); Phenotype: undefined; Source study: blattner
Gene/Ortholog: eco2244 (OG4_10366); Phenotype: undefined; Source study: gerdes
Gene/Ortholog: eco2244 (OG4_10366); Phenotype: essential; Source study: keio
Gene/Ortholog: eco2244 (OG4_10366); Phenotype: non-essential; Source study: shigen
Gene/Ortholog: Tb927.10.7520 (OG4_10366); Phenotype: no significant loss or gain of fitness in bloodstream forms (3 days); Source study: alsford
Gene/Ortholog: Tb927.10.7520 (OG4_10366); Phenotype: no significant loss or gain of fitness in bloodstream forms (6 days); Source study: alsford
Gene/Ortholog: Tb927.10.7520 (OG4_10366); Phenotype: no significant loss or gain of fitness in procyclic forms; Source study: alsford
Gene/Ortholog: Tb927.10.7520 (OG4_10366); Phenotype: no significant loss or gain of fitness in differentiation of procyclic to bloodstream forms; Source study: alsford
Is it a monomer or multimer as biological unit? (make prediction at http://www.ebi.ac.uk/msd-srv/prot_int/pistart.html): It is monomeric.
Complex of proteins?: No
Druggable Target (list number or cite evidence from a paper/database showing druggable in another organism):
http://www.sciencedirect.com/science/article/pii/S0166685110000630
*EC#: 6.3.2.12
Link to BRENDA EC# page:
http://www.brenda-enzymes.org/enzyme.php?ecno=6.3.2.12&Suchword=&reference=&UniProtAcc=F4JYE9&organism%5B%5D=&show_tm=0
Enzyme Assay information (spectrophotometric, coupled assay ?, reagents): Spectrophotometric
https://www.ncbi.nlm.nih.gov/pubmed/17134675
https://www.thermofisher.com/antibody/product/Glutamine-Synthetase-Antibody-clone-7H9L16-Monoclonal/701989?pluginName=
http://angene.lookchem.com/products/CasNo-37318-62-0-SYNTHETASE-DIHYDROFOLATE-6162568.html
Structure (PDB or Homology model)
-- PDB # or closest PDB entry if using homology model: 3N2A
Current Inhibitors: Most inhibitors are sulfonamides. H2-folate, and antimetabolite dihydrohomopteroate.
Expression Information (has it been expressed in bacterial cells): It has been expressed in E. coli plasmids.
Purification Method: Purification methods include ammonium sulfate fractionation, isoelectric focusing, polyacrylamide gel electrophoresis, and column chromatography using various types of products.
Image of protein (PyMol with features delineated and shown separately):
*Amino Acid Sequence (paste as text only - not as screenshot or as 'code'):
Sequence and secondary structure for 3N2A chain A
SNAMNNHQTP QATSPLAAWL CYLEHLHSQP IELGLERVKQ VAERLDLLKPAPKIFTVAGT NGKGTTCCTL EAILLAAGLR VGVYSSPHLL RYTERVRIQG
QELSEAEHSH SFAQIEAGRG DISLTYFEFG TLSALQLFKQ AKLDVVILEV
GLGGRLDATN IVDSDVAAIT SIALDHTDWL GYDRESIGRE KAGVFRGGKP
AVVGEPDMPQ SIADVAAELG AQLYRRDVAW KFSQQEPFDQ QEPVDQQING
WHWQCGERQL TGLPVPNVPL ANAATALAVL HYSELPLSDE AIRQGLQAAS
LPGRFQVVSE QPLLILDVAH NPHAARYLVN RLAQVINPVN ASKQGKVRAV
VGMLSDKDIA GTLACLSERV DEWYCAPLEG PRGASAGQLA EHLVSARQFS
DVETAWRQAM QDADTQDVVI VCGSFHTVAH VMAALHL
Length of your protein in Amino Acids: 437 residues
Molecular Weight of your protein in kiloDaltons using the Expasy ProtParam website: 47500.87
Molar Extinction coefficient of your protein at 280 nm wavelength: 52, 285 1/Mcm, assuming all pairs of Cys residues form cystines and 51,910 1/Mcm assuming all Cys residues are reduced.
TMpred graph Image (http://www.ch.embnet.org/software/TMPRED_form.html). Input your amino acid sequence to it.
*CDS Gene Sequence (paste as text only):
GTGTCGAGGTCGCTGGCACAACGTTATAGGGCTGAGGCTTACAACGTCATCGCCACTGCG ACTTGCACACGGCCGACCGAGCTGGTTATCGATGGCATTGACGTGACTCAGGCGGAGTTC GAATATGCGGTGACCTATGAATGTGCATTGGATGTTGCCGACCACGCCAATGAGTTCGAC ACACGGGCCACAGCACCGCAGCGACCTGTGCGAGTCAGCATCGGACGGGGCATTGTTGGG GTGATTGAGGCCTTGGGTG
*GC% Content for gene: 57.76
*CDS Gene Sequence (codon optimized) - copy from output of Primer Design Protocol (paste as text only): n/a
*GC% Content for gene (codon optimized): n/a
Do Not Need this info for Spring
Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers):
(link to DNA Works output text file - that should be saved in your Google Docs folder after you did the primer design protocol)
-- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to.
Primer design results for 'tail' primers (this is just 2 sequences):
**